PlantPromoterDB promoter information of AT1G21720.1
Summary of Gene (AT1G21720.1)
|
Overview
|
Focused view (chromosome 1: 7625394-7626593)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G21720.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G21720.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 30 | + | 7626335 | -59 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | + | 7626289 | -105 |
| TSS clone | C | clone | + | 7626293 | -101 |
| TSS clone | A | clone | + | 7626307 | -87 |
| TSS clone | T | clone | + | 7626330 | -64 |
| TSS clone | C | clone | + | 7626333 | -61 |
| TSS clone | C | clone | + | 7626334 | -60 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCCCTCTCTCTCCCCTCCTCCTTC | + | 7626308 | 7626332 | -86 | -62 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GAAGCCCAATAA | + | 7626203 | 7626214 | -191 | -180 | |||
| AtREG476 | GAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG417 | CCCAATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGCCTAAATTAGGCCCAAAA | + | 7626220 | 7626239 | -174 | -155 | |||
| AtREG430 | GGCCTAAA | PPDB Motif | PLACE Motif | ||||||
| AtREG506 | ATTAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG360 | TTAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG358 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG373 | GGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG529 | GCCCAAAA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||