PlantPromoterDB promoter information of AT1G22530

Summary of Gene (AT1G22530)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G22530 TAIR NCBI
Gene model	AT1G22530
Description	PATELLIN 2 (PATL2); FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: PATL1 (PATELLIN 1); transporter (TAIR:AT1G72150.1); Has 52283 Blast hits to 28572 proteins in 1631 species: Archae - 214; Bacteria - 8910; Metazoa - 20172; Fungi - 6486; Plants - 2360; Viruses - 305; Other Eukaryotes - 13836 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 7959326-7958127)

`Genome position from initiation codon` `AT1G22530.1 TSS from cDNA TSS information AT1G22530 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G22530

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 38 - 7958380 -54

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	38	-	7958380	-54

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 7958479 -153

TSS clone A clone - 7958442 -116

TSS clone T clone - 7958410 -84

TSS clone A clone - 7958408 -82

TSS clone T clone - 7958384 -58

TSS clone C clone - 7958381 -55

TSS clone A clone - 7958380 -54

TSS clone A clone - 7958379 -53

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	7958479	-153
TSS clone	`A`	clone	-	7958442	-116
TSS clone	`T`	clone	-	7958410	-84
TSS clone	`A`	clone	-	7958408	-82
TSS clone	`T`	clone	-	7958384	-58
TSS clone	`C`	clone	-	7958381	-55
TSS clone	`A`	clone	-	7958380	-54
TSS clone	`A`	clone	-	7958379	-53

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CATCTCTCTCTCTCTTTCT - 7958357 7958375 -31 -49

Y Patch CTCTTCTTCTTCTTCTTCTCTCTC - 7958381 7958404 -55 -78

Y Patch TTCTCTCTTCTCTCTTT - 7958414 7958430 -88 -104

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CATCTCTCTCTCTCTTTCT`	-	7958357	7958375	-31	-49
Y Patch	`CTCTTCTTCTTCTTCTTCTCTCTC`	-	7958381	7958404	-55	-78
Y Patch	`TTCTCTCTTCTCTCTTT`	-	7958414	7958430	-88	-104
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TGGGACCC - 7958534 7958541 -208 -215

AtREG596 TGGGACCC PPDB Motif GGGACCC PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TGGGACCC`		-	7958534	7958541	-208	-215
	AtREG596	`TGGGACCC`		PPDB Motif	`GGGACCC`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None