version
PlantPromoterDB promoter information of AT1G22960.1

Summary of Gene (AT1G22960.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G22960  TAIR      NCBI 
Gene model AT1G22960.1  
Description pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 8131242-8130043)

Genome position     
from initiation codon
AT1G22970.1         
TSS from cDNA
TSS information
AT1G22960.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G22960.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-8130392-150

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGAACCGGTCCGGTTAAG-81304488130466-206-224
 AtREG640TTGAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528  GAACCGGT          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573        GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621         TCCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501          CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605           CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTTAACCG-81304928130499-250-257
 AtREG645TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTTAACGG-81305018130508-259-266
 AtREG610TTTAACGG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGTTTAACCGGTC-81305528130562-310-320
 AtREG645TTTAACCG    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503  TAACCGGT  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG552   AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAAACCGGT-81305818130590-339-348
 AtREG519GTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.