PlantPromoterDB promoter information of AT1G23400.1
Summary of Gene (AT1G23400.1)
|
Overview
|
Focused view (chromosome 1: 8315740-8314541)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G23400.1 5'->3' (-) Promoter sequence AT1G23410.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G23400.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 5 | - | 8314748 | -8 |
| TSS peak | A | 5 | - | 8314744 | -4 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 8314744 | -4 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTCTTCTCTTC | - | 8314697 | 8314708 | 43 | 32 |
| Y Patch | TCTTCTTCTTCTCT | - | 8314749 | 8314762 | -9 | -22 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CGATGTCG | - | 8314800 | 8314807 | -60 | -67 | |||
| AtREG630 | CGATGTCG | PPDB Motif | PLACE Motif | ||||||
| REG | TAAAGCCC | - | 8314820 | 8314827 | -80 | -87 | |||
| AtREG365 | TAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TTATGGGCCTGGCCTTAGGGCCCAATT | - | 8314835 | 8314861 | -95 | -121 | |||
| AtREG394 | TTATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG364 | TATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG370 | TGGGCCTG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG619 | GGGCCTGG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG577 | GGCCTTAG | PPDB Motif | PLACE Motif | ||||||
| AtREG387 | TAGGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG400 | AGGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG392 | GGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG418 | GCCCAATT | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||