version
PlantPromoterDB promoter information of AT1G23740

Summary of Gene (AT1G23740)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G23740  TAIR      NCBI 
Gene model AT1G23740  
Description oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 8400656-8399457)

Genome position     
from initiation codon
AT1G23740.1         
TSS from cDNA
TSS information
AT1G23740                        5'->3' (-)
Promoter sequence







 
AT1G23750.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G23740

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-8399672-16

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8399686-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGCCACG-83997318399738-75-82
 AtREG608AAGCCACGABA PPDB Motif  PLACE MotifGCCAC 
REGTTATGGGCCAC-83997988399808-142-152
 AtREG394TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  ATGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445   TGGGCCAC PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
REGAAACCGAA-83998958399902-239-246
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTAGGCCCATTAA-83999508399963-294-307
 AtREG430TTTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+8400204AT1G23750.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+8400160AT1G23750.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCC+84001708400177AT1G23750.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAATGGGCCTAAA+83999508399963AT1G23750.1
 AtREG396TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430      GGCCTAAA PPDB Motif  PLACE Motif 
REGAATTGGGCTTTAT+83999698399981AT1G23750.1
 AtREG418AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601     GGCTTTAT PPDB Motif  PLACE Motif 
REGATAAGCCCAACA+83999848399995AT1G23750.1
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574   AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543    GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGGTACACGTGTT+84000798400089AT1G23750.1
 AtREG562GTACACGT   ABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG453 TACACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG590   CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.