version
PlantPromoterDB promoter information of AT1G23900.2

Summary of Gene (AT1G23900.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G23900  TAIR      NCBI 
Gene model AT1G23900.2  
Description Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane  
#
#

Overview

Focused view (chromosome 1: 8440379-8441578)

Genome position     
from initiation codon
AT1G23900.1         
TSS from cDNA
TSS information
AT1G23900.2                      5'->3' (+)
Promoter sequence











 
AT1G23890.1         
AT1G23890.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G23900.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+8441150-229
TSS peakC2+8441286-93

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+8441146-233
TSS cloneAclone+8441167-212

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTCC+84412918441300-88-79
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCTGA+84409018440908-478-471
 AtREG374GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAAACGGCCCAAGTAGGGCCCATTTA+84410018441026-378-353
 AtREG531AAAACGGC                   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG377  AACGGCCC                 PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG368   ACGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414    CGGCCCAA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505     GGCCCAAG              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387             TAGGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG400              AGGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391               GGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361                GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386                 GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443                  CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGAACGGCCCAGT+84410458441055-334-324
 AtREG377AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG368 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384   GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-8440866AT1G23890.2, AT1G23890.1
TSS clone peakAclone-8440848AT1G23890.2, AT1G23890.1
TSS cloneCclone-8440824AT1G23890.2, AT1G23890.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCCTCT-84408148440824AT1G23890.1, AT1G23890.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCAGGCCC-84409018440908AT1G23890.1, AT1G23890.2
 AtREG374TCAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGGCCCTACTTGGGCCGTTTT-84410018441026AT1G23890.1, AT1G23890.2
 AtREG443TAAATGGG                   PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391   ATGGGCCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400    TGGGCCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387     GGGCCCTA              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG505             CTTGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414              TTGGGCCG     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368               TGGGCCGT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377                GGGCCGTT   PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG531                  GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACTGGGCCGTT-84410458441055AT1G23890.1, AT1G23890.2
 AtREG384ACTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377   GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.