PlantPromoterDB promoter information of AT1G24010.1

Summary of Gene (AT1G24010.1)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G24010 TAIR NCBI
Gene model	AT1G24010.1
Description	FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: embryo, guard cell, pedicel, root, carpel; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: Bet v I allergen family protein (TAIR:AT1G24000.1); Has 23 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 8484314-8483115)

`Genome position from initiation codon` `AT1G23970.1 AT1G23970.2 TSS from cDNA TSS information AT1G24010.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G24010.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 5 - 8483853 AT1G23970.1, AT1G23970.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	5	-	8483853	AT1G23970.1, AT1G23970.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone - 8483870 AT1G23970.1, AT1G23970.2

TSS clone A clone - 8483848 AT1G23970.1, AT1G23970.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	-	8483870	AT1G23970.1, AT1G23970.2
TSS clone	`A`	clone	-	8483848	AT1G23970.1, AT1G23970.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box CAATATAA - 8483879 8483886 AT1G23970.1, AT1G23970.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CAATATAA`	-	8483879	8483886	AT1G23970.1, AT1G23970.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG AAAAAGCCCAACTGAAGCCCATAA - 8483924 8483947 AT1G23970.1, AT1G23970.2

AtREG589 AAAAAGCC                 PPDB Motif PLACE Motif

AtREG409 AAAAGCCC                PPDB Motif GCCCA PLACE Motif

AtREG376   AAAGCCCA               PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG407    AAGCCCAA              PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG574     AGCCCAAC             PPDB Motif GCCCA, CCAACGG PLACE Motif TGGGCY

AtREG607      GCCCAACT            PPDB Motif GCCCA PLACE Motif

AtREG476              GAAGCCCA    PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG378               AAGCCCAT   PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG477                AGCCCATA PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG394                 GCCCATAA PPDB Motif GCCCA PLACE Motif