PlantPromoterDB promoter information of AT1G24020

Summary of Gene (AT1G24020)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G24020 TAIR NCBI
Gene model	AT1G24020
Description	MLP-LIKE PROTEIN 423 (MLP423); INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 930 Blast hits to 901 proteins in 105 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 922; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 8503408-8502209)

`Genome position from initiation codon` `TSS from cDNA TSS information AT1G24020 5'->3' (-) Promoter sequence AT1G24030.1 AT1G24030.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G24020

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 13 - 8501513 -55

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	13	-	8501513	-55

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone - 8501516 -58

TSS clone A clone - 8501510 -52

TSS clone A clone - 8501506 -48

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	-	8501516	-58
TSS clone	`A`	clone	-	8501510	-52
TSS clone	`A`	clone	-	8501506	-48

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TCTCTATATATAGA - 8501538 8501551 -80 -93

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTCTATATATAGA`	-	8501538	8501551	-80	-93
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGCTTTAA - 8501556 8501563 -98 -105

AtREG545 GGCTTTAA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGCTTTAA`		-	8501556	8501563	-98	-105
	AtREG545	`GGCTTTAA`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone peak G clone + 8503253 AT1G24030.1, AT1G24030.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone peak	`G`	clone	+	8503253	AT1G24030.1, AT1G24030.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box ACTCTATAT + 8503208 8503216 AT1G24030.1, AT1G24030.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`ACTCTATAT`	+	8503208	8503216	AT1G24030.1, AT1G24030.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCAAACCG + 8502996 8503003 AT1G24030.1, AT1G24030.2

AtREG550 CCAAACCG PPDB Motif AACCG(G/A) PLACE Motif