version
PlantPromoterDB promoter information of AT1G24020

Summary of Gene (AT1G24020)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G24020  TAIR      NCBI 
Gene model AT1G24020  
Description MLP-LIKE PROTEIN 423 (MLP423); INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 930 Blast hits to 901 proteins in 105 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 922; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 8508108-8506909)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G24020                        5'->3' (-)
Promoter sequence










 
AT1G24050.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G24020

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-8501513-55

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-8501516-58
TSS cloneAclone-8501510-52
TSS cloneAclone-8501506-48

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATATATAGA-85015388501551-80-93
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCTTTAA-85015568501563-98-105
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG20+8507020AT1G24050.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+8507020AT1G24050.1
TSS cloneAclone+8507021AT1G24050.1
TSS cloneGclone+8507027AT1G24050.1
TSS cloneGclone+8507033AT1G24050.1
TSS cloneGclone+8507034AT1G24050.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATATAGT+85069878506997AT1G24050.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGGCCCTTATGGCCCATATA+85069028506922AT1G24050.1
 AtREG400TGGGCCCT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG616   GCCCTTAT           PPDB Motif  PLACE Motif 
 AtREG479        TATGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437         ATGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490          TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364           GGCCCATA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432            GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620             CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTAAGGCCCA+85069628506979AT1G24050.1
 AtREG421ATTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG416        TTAAGGCC   PPDB Motif  PLACE Motif 
 AtREG351         TAAGGCCC  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353          AAGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTATATGGGCCATAAGGGCCCA-85069028506922AT1G24040.1, AT1G24040.2
 AtREG620TATATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437    TGGGCCAT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479     GGGCCATA         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG616          ATAAGGGC    PPDB Motif  PLACE Motif 
 AtREG400             AGGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATATGGGCCTTAAGCCCAAAT-85069628506982AT1G24040.1, AT1G24040.2
 AtREG432ATATGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416     GGCCTTAA         PPDB Motif  PLACE Motif 
 AtREG426          TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469            AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421             GCCCAAAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.