version
PlantPromoterDB promoter information of AT1G24520.1

Summary of Gene (AT1G24520.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G24520  TAIR      NCBI 
Gene model AT1G24520.1  
Description Male fertility gene acting on tapetum and microspore  
#
#

Overview

Focused view (chromosome 1: 8687699-8688898)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G24520.1                      5'->3' (+)
Promoter sequence





 
AT1G24510.1         
AT1G24510.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G24520.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+8688629-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATATATACA+86885948688605-105-94
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGCCCATCT+86883328688344-367-355
 AtREG545TTAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG572     GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-8688214AT1G24510.1, AT1G24510.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-8688213AT1G24510.1, AT1G24510.2
TSS cloneCclone-8688201AT1G24510.1, AT1G24510.2
TSS cloneTclone-8688200AT1G24510.1, AT1G24510.2
TSS cloneCclone-8688159AT1G24510.1, AT1G24510.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCC-86881668688174AT1G24510.1, AT1G24510.2
Y PatchTTCTTCTTCTC-86882038688213AT1G24510.1, AT1G24510.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTTAGGCCCATG-86882998688310AT1G24510.1, AT1G24510.2
 AtREG535GTTAGGCC     PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504    GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGATAAGCCCAAAC-86883168688327AT1G24510.1, AT1G24510.2
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469   AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCTTTAA-86883328688344AT1G24510.1, AT1G24510.2
 AtREG572AGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.