PlantPromoterDB promoter information of AT1G25550

Summary of Gene (AT1G25550)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G25550 TAIR NCBI
Gene model	AT1G25550
Description	myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G68670.1); Has 883 Blast hits to 881 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 869; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 8973794-8974993)

`Genome position from initiation codon` `TSS from cDNA TSS information AT1G25550 5'->3' (+) Promoter sequence AT1G25540.1 AT1G25540.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G25550

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 10 + 8976538 -106

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	10	+	8976538	-106

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 8976538 -106

TSS clone T clone + 8976539 -105

TSS clone T clone + 8976553 -91

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	8976538	-106
TSS clone	`T`	clone	+	8976539	-105
TSS clone	`T`	clone	+	8976553	-91

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CCTCTTTCTCT + 8976489 8976499 -155 -145

Y Patch CTTTCTCTCTCAT + 8976541 8976553 -103 -91

Y Patch CTCTTCTCT + 8976567 8976575 -77 -69

Y Patch TCTCTCTC + 8976577 8976584 -67 -60

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CCTCTTTCTCT`	+	8976489	8976499	-155	-145
Y Patch	`CTTTCTCTCTCAT`	+	8976541	8976553	-103	-91
Y Patch	`CTCTTCTCT`	+	8976567	8976575	-77	-69
Y Patch	`TCTCTCTC`	+	8976577	8976584	-67	-60
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TCGTCGTT + 8976253 8976260 -391 -384

AtREG648 TCGTCGTT PPDB Motif PLACE Motif

REG TTCGGTTT + 8976444 8976451 -200 -193

AtREG568 TTCGGTTT PPDB Motif AACCG(G/A) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TCGTCGTT`		+	8976253	8976260	-391	-384
	AtREG648	`TCGTCGTT`		PPDB Motif		PLACE Motif
REG	`TTCGGTTT`		+	8976444	8976451	-200	-193
	AtREG568	`TTCGGTTT`		PPDB Motif	`AACCG(G/A)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None