version
PlantPromoterDB promoter information of AT1G26640.1

Summary of Gene (AT1G26640.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G26640  TAIR      NCBI 
Gene model AT1G26640.1  
Description aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 9210766-9209567)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G26640.1                      5'->3' (-)
Promoter sequence









 
AT1G26650.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G26640.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-9209844-78

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-9209900-134
TSS cloneAclone-9209897-131
TSS cloneAclone-9209877-111
TSS cloneAclone-9209820-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTAATGGGCTTC-92099489209960-182-194
 AtREG604CTTAATGG      PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476     TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTTAGGCCCAATAA-92099649209977-198-211
 AtREG535GTTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGAACCCGGTTTG-92099969210006-230-240
 AtREG516AACCCGGT    PPDB Motif  PLACE Motif 
 AtREG455 ACCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496   CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+9210064AT1G26650.1
TSS clone peakGclone+9210066AT1G26650.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGGAAA+92098799209886AT1G26650.1
 AtREG644ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAAGCCCATTAAG+92099489209960AT1G26650.1
 AtREG476GAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604     CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGTTATTGGGCCTAAC+92099649209977AT1G26650.1
 AtREG417TTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG535      GGCCTAAC PPDB Motif  PLACE Motif 
REGCAAACCGGGTT+92099969210006AT1G26650.1
 AtREG496CAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG455  AACCGGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG516   ACCGGGTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.