version
PlantPromoterDB promoter information of AT1G29880.1

Summary of Gene (AT1G29880.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G29880  TAIR      NCBI 
Gene model AT1G29880.1  
Description glycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10463781-10462582)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G29880.1                      5'->3' (-)
Promoter sequence





 
AT1G29890.1         
AT1G29890.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G29880.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-10462795-14

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-10462801-20
TSS cloneAclone-10462798-17
TSS cloneAclone-10462795-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCT-1046276710462774147
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTGGGCCCAAA-1046284810462859-67-78
 AtREG505CTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392 TTGGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTATTGGG-1046289210462899-111-118
 AtREG417TTATTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+10463416AT1G29890.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+10463463AT1G29890.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTTCTTCTTCTTC+1046339710463415AT1G29890.2
Y PatchTCTCTCTCTTC+1046344510463455AT1G29890.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAACGACGTC+1046333710463347AT1G29890.2
 AtREG520AAAACGAC    PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG   PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTC PPDB MotifACGT  PLACE MotifACGT 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.