version
PlantPromoterDB promoter information of AT1G30640

Summary of Gene (AT1G30640)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G30640  TAIR      NCBI 
Gene model AT1G30640  
Description protein kinase, putative; FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, C-terminal (InterPro:IPR017892), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G14350.3); Has 82196 Blast hits to 81189 proteins in 2930 species: Archae - 64; Bacteria - 7641; Metazoa - 35591; Fungi - 7931; Plants - 14313; Viruses - 376; Other Eukaryotes - 16280 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10860297-10861496)

Genome position     
from initiation codon
AT1G30640.1         
TSS from cDNA
TSS information
AT1G30640                        5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G30640

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+10860715-582

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAGCCCATTGGGCCTAAA-1086034610860365AT1G30630.1
 AtREG409AAAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551    GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461       CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352        ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356         TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358          TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360           GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430            GGCCTAAA PPDB Motif  PLACE Motif 
REGTAATTGGG-1086037210860379AT1G30630.1
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGAAAACGCGTTTTA-1086044510860457AT1G30630.1
 AtREG566AAAACGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633 AAACGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564     GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGTGACA-1086051810860525AT1G30630.1
 AtREG606ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.