version
PlantPromoterDB promoter information of AT1G30880.1

Summary of Gene (AT1G30880.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G30880  TAIR      NCBI 
Gene model AT1G30880.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10995056-10993857)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G30880.1                      5'->3' (-)
Promoter sequence











 
AT1G30890.1         
AT1G30890.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G30880.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG7-10994095-39

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-10994125-69
TSS cloneCclone-10994101-45
TSS cloneCclone-10994100-44
TSS cloneTclone-10994099-43
TSS cloneGclone-10994095-39
TSS cloneCclone-10994094-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTTATAAAAG-1099412610994136-70-80
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAACCGGA-1099416810994175-112-119
 AtREG579GAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTTGGGCCTAAATTGGGCCAAT-1099423310994255-177-199
 AtREG421ATTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430     GGCCTAAA           PPDB Motif  PLACE Motif 
 AtREG418           AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352            ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420             TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484              TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446               GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAGGGTATT-1099429110994299-235-243
 AtREG623AAGGGTAT  PPDB MotifACCCT  PLACE Motif 
 AtREG567 AGGGTATT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC4+10994345AT1G30890.1, AT1G30890.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+10994322AT1G30890.1, AT1G30890.2
TSS cloneAclone+10994346AT1G30890.1, AT1G30890.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTC+1099429610994303AT1G30890.1, AT1G30890.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCCGGTTC+1099416810994175AT1G30890.1, AT1G30890.2
 AtREG579TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTGGCCCAATTTAGGCCCAAAT+1099423310994255AT1G30890.1, AT1G30890.2
 AtREG446ATTGGCCC               CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484 TTGGCCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TGGCCCAA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418    GCCCAATT            PPDB MotifGCCCA  PLACE Motif 
 AtREG430          TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360           TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358            TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356             AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373              GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421               GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAATACCCTT+1099429110994299AT1G30890.1, AT1G30890.2
 AtREG567AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623 ATACCCTT PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.