version
PlantPromoterDB promoter information of AT1G30890.1

Summary of Gene (AT1G30890.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G30890  TAIR      NCBI 
Gene model AT1G30890.1  
Description integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10993890-10995089)

Genome position     
from initiation codon
AT1G30890.2         
TSS from cDNA
TSS information
AT1G30890.1                      5'->3' (+)
Promoter sequence












 
AT1G30880.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G30890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC4+10994345-545

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+10994322-568
TSS cloneAclone+10994346-544

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTC+1099429610994303-594-587
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGTTC+1099416810994175-722-715
 AtREG579TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTGGCCCAATTTAGGCCCAAAT+1099423310994255-657-635
 AtREG446ATTGGCCC               CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484 TTGGCCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TGGCCCAA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418    GCCCAATT            PPDB MotifGCCCA  PLACE Motif 
 AtREG430          TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360           TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358            TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356             AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373              GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421               GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAATACCCTT+1099429110994299-599-591
 AtREG567AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623 ATACCCTT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG7-10994095AT1G30880.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-10994125AT1G30880.1
TSS cloneCclone-10994101AT1G30880.1
TSS cloneCclone-10994100AT1G30880.1
TSS cloneTclone-10994099AT1G30880.1
TSS cloneGclone-10994095AT1G30880.1
TSS cloneCclone-10994094AT1G30880.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTTATAAAAG-1099412610994136AT1G30880.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAACCGGA-1099416810994175AT1G30880.1
 AtREG579GAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTTGGGCCTAAATTGGGCCAAT-1099423310994255AT1G30880.1
 AtREG421ATTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430     GGCCTAAA           PPDB Motif  PLACE Motif 
 AtREG418           AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352            ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420             TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484              TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446               GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAGGGTATT-1099429110994299AT1G30880.1
 AtREG623AAGGGTAT  PPDB MotifACCCT  PLACE Motif 
 AtREG567 AGGGTATT PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.