PlantPromoterDB promoter information of AT1G31170.1
Summary of Gene (AT1G31170.1)
|
Overview
|
Focused view (chromosome 1: 11132521-11133720)
|
Genome position
from initiation codon AT1G31170.3 TSS from cDNA TSS information AT1G31170.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G31170.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 5 | + | 11133498 | -23 |
| TSS peak | G | 5 | + | 11133517 | -4 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | + | 11133514 | -7 |
| TSS clone | G | clone | + | 11133515 | -6 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CTTTATAT | + | 11133454 | 11133461 | -67 | -60 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTGGGCTTAAGTTGGGCTTT | + | 11133351 | 11133370 | -170 | -151 | |||
| AtREG518 | GTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG426 | TGGGCTTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG607 | AGTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG574 | GTTGGGCT | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | TGGGCY | ||||
| AtREG407 | TTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | GAAACGACGCCGT | + | 11133405 | 11133417 | -116 | -104 | |||
| AtREG576 | GAAACGAC | PPDB Motif | PLACE Motif | ||||||
| AtREG415 | AAACGACG | PPDB Motif | PLACE Motif | ||||||
| AtREG439 | AACGACGC | PPDB Motif | PLACE Motif | ||||||
| AtREG537 | ACGACGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG540 | GACGCCGT | PPDB Motif | PLACE Motif | ||||||
| REG | ACGTCGTCGTTTT | + | 11133437 | 11133449 | -84 | -72 | |||
| AtREG526 | ACGTCGTC | PPDB Motif | ACGT | PLACE Motif | ACGT | ||||
| AtREG648 | TCGTCGTT | PPDB Motif | PLACE Motif | ||||||
| AtREG415 | CGTCGTTT | PPDB Motif | PLACE Motif | ||||||
| AtREG520 | GTCGTTTT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||