version
PlantPromoterDB promoter information of AT1G33030.1

Summary of Gene (AT1G33030.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G33030  TAIR      NCBI 
Gene model AT1G33030.1  
Description O-methyltransferase family 2 protein; FUNCTIONS IN: O-methyltransferase activity; INVOLVED IN: lignin biosynthetic process; LOCATED IN: cytosol; EXPRESSED IN: stem, stamen, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: ATOMT1 (O-METHYLTRANSFERASE 1); caffeate O-methyltransferase/ myricetin 3'-O-methyltransferase/ quercetin 3-O-methyltransferase (TAIR:AT5G54160.1); Has 2066 Blast hits to 2064 proteins in 423 species: Archae - 0; Bacteria - 584; Metazoa - 76; Fungi - 395; Plants - 923; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 11967212-11966013)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G33030.1                      5'->3' (-)
Promoter sequence











 
AT1G33040.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G33030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11966276-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAAGCCCATTGGGCCTCA-1196639811966417-186-205
 AtREG549TAAAAGCC             PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC            PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551     GCCCATTG        PPDB MotifGCCCA  PLACE Motif 
 AtREG461        CATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352         ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG447           TGGGCCTC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG587            GGGCCTCA PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+11966500AT1G33040.1
TSS cloneAclone+11966510AT1G33040.1
TSS cloneGclone+11966511AT1G33040.1
TSS cloneTclone+11966515AT1G33040.1
TSS cloneGclone+11966517AT1G33040.1
TSS clone peakCclone+11966518AT1G33040.1
TSS cloneGclone+11966536AT1G33040.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAGGCCCAATGGGCTTTTA+1196639811966417AT1G33040.1
 AtREG587TGAGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461    GCCCAATG         PPDB MotifGCCCA  PLACE Motif 
 AtREG551       CAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372        AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376          TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409           GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549            GGCTTTTA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.