version
PlantPromoterDB promoter information of AT1G33390.1

Summary of Gene (AT1G33390.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G33390  TAIR      NCBI 
Gene model AT1G33390.1  
Description helicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 12105108-12103909)

Genome position     
from initiation codon
AT1G33400.1         
TSS from cDNA
TSS information
AT1G33390.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G33390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-12104561-453

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTC-1210455012104559-442-451
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGGCGT-1210461112104619-503-511
 AtREG524AAACGGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497 AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGAAAACGACA-1210465312104661-545-553
 AtREG520AAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 
REGATTTGGGC-1210469312104700-585-592
 AtREG421ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGAAAACGACGA-1210470312104712-595-604
 AtREG520AAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG648  AACGACGA PPDB Motif  PLACE Motif 
REGAACGACGT-1210476812104775-660-667
 AtREG493AACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGGTCCGGTTTAG-1210481212104822-704-714
 AtREG573GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTAGGCCGGTTTAG-1210482812104842-720-734
 AtREG506ATTAGGCC        PPDB Motif  PLACE Motif 
 AtREG412      CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511       CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.