PlantPromoterDB promoter information of AT1G35580.2
Summary of Gene (AT1G35580.2)
|
Overview
|
Focused view (chromosome 1: 13125808-13124609)
|
Genome position
from initiation codon AT1G35580.3 TSS from cDNA TSS information AT1G35580.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G35580.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 2 | - | 13125245 | -437 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | - | 13125263 | -455 |
| TSS clone | T | clone | - | 13125262 | -454 |
| TSS clone | T | clone | - | 13125259 | -451 |
| TSS clone | T | clone | - | 13125256 | -448 |
| TSS clone | T | clone | - | 13125251 | -443 |
| TSS clone | T | clone | - | 13125215 | -407 |
| TSS clone | C | clone | - | 13125210 | -402 |
| TSS clone | G | clone | - | 13125205 | -397 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CGTCTTCTCTCTTCTCTCAT | - | 13125215 | 13125234 | -407 | -426 |
| Y Patch | TTCCTTCTTCTTCCCTCTCCT | - | 13125246 | 13125266 | -438 | -458 |
| Y Patch | TCTTCTTC | - | 13125286 | 13125293 | -478 | -485 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCGTTAAA | - | 13125326 | 13125333 | -518 | -525 | |||
| AtREG610 | CCGTTAAA | PPDB Motif | PLACE Motif | YAACKG, CNGTTR | |||||
| REG | ACCGGTTATAACCGGT | - | 13125375 | 13125390 | -567 | -582 | |||
| AtREG503 | ACCGGTTATAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG548 | CCGGTTATAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| REG | TCGTCGTTTAGTCCACGTAG | - | 13125414 | 13125433 | -606 | -625 | |||
| AtREG648 | TCGTCGTT | PPDB Motif | PLACE Motif | ||||||
| AtREG415 | CGTCGTTT | PPDB Motif | PLACE Motif | ||||||
| AtREG565 | GTCGTTTA | PPDB Motif | PLACE Motif | ||||||
| AtREG513 | GTCCACGT | ABA, DREB1Aox | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||
| AtREG495 | CCACGTAG | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | ||||
| REG | TCAGCCCA | - | 13125447 | 13125454 | -639 | -646 | |||
| AtREG609 | TCAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||