PlantPromoterDB promoter information of AT1G43170.4
Summary of Gene (AT1G43170.4)
|
Overview
|
Focused view (chromosome 1: 16266519-16267718)
|
Genome position
from initiation codon AT1G43170.2 AT1G43170.3 TSS from cDNA TSS information AT1G43170.4 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G43170.4
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 73 | + | 16266751 | -768 |
| TSS peak | T | 8 | + | 16267263 | -256 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | + | 16266740 | -779 |
| TSS clone | T | clone | + | 16266741 | -778 |
| TSS clone | T | clone | + | 16266745 | -774 |
| TSS clone | T | clone | + | 16266747 | -772 |
| TSS clone | C | clone | + | 16266748 | -771 |
| TSS clone | T | clone | + | 16266749 | -770 |
| TSS clone | G | clone | + | 16266751 | -768 |
| TSS clone | C | clone | + | 16266752 | -767 |
| TSS clone | A | clone | + | 16266753 | -766 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TACTATAAATT | + | 16266708 | 16266718 | -811 | -801 |
| Y Patch | TTTCTCTCTT | + | 16266741 | 16266750 | -778 | -769 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TGTTGGGCTTTAGGCCCAAAA | + | 16266642 | 16266662 | -877 | -857 | |||
| AtREG543 | TGTTGGGC | PPDB Motif | GCCCA | PLACE Motif | CAACA | ||||
| AtREG574 | GTTGGGCT | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | TGGGCY | ||||
| AtREG407 | TTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG365 | GGGCTTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG430 | TTTAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG360 | TTAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG358 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG373 | GGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG529 | GCCCAAAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TCGGCCCATAT | + | 16266669 | 16266679 | -850 | -840 | |||
| AtREG393 | TCGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG380 | CGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG364 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG432 | GCCCATAT | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||