version
PlantPromoterDB promoter information of AT1G44575.1

Summary of Gene (AT1G44575.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G44575  TAIR      NCBI 
Gene model AT1G44575.1  
Description Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation.  
#
#

Overview

Focused view (chromosome 1: 16870768-16871967)

Genome position     
from initiation codon
AT1G44575.2         
TSS from cDNA
TSS information
AT1G44575.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G44575.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA31+16871761-7

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+16871721-47
TSS cloneAclone+16871726-42
TSS cloneCclone+16871729-39
TSS cloneAclone+16871730-38
TSS cloneAclone+16871731-37
TSS cloneTclone+16871756-12
TSS cloneTclone+16871759-9
TSS cloneAclone+16871761-7
TSS cloneGclone+16871762-6
TSS cloneGclone+16871766-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCTCTCAT+1687174516871756-23-12
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAATTGGG+1687164616871653-122-115
 AtREG647CAATTGGG PPDB Motif  PLACE Motif 
REGACGTGGAC+1687165616871663-112-105
 AtREG513ACGTGGACABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTAAGCCCATCA+1687167016871680-98-88
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.