version
PlantPromoterDB promoter information of AT1G44750.2

Summary of Gene (AT1G44750.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G44750  TAIR      NCBI 
Gene model AT1G44750.2  
Description Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.  
#
#

Overview

Focused view (chromosome 1: 16892825-16894024)

Genome position     
from initiation codon
AT1G44750.3         
TSS from cDNA
TSS information
AT1G44750.2                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G44750.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+16893754-71

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+16893719-106
TSS cloneAclone+16893723-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAACCGG+1689358316893590-242-235
 AtREG548ATAACCGG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTCCGGTTTAA+1689363316893642-192-183
 AtREG521TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGATGGGCTAA+1689364616893656-179-169
 AtREG635TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG581  ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571   TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAGTCAA+1689366216893669-163-156
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.