version
PlantPromoterDB promoter information of AT1G48440.1

Summary of Gene (AT1G48440.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G48440  TAIR      NCBI 
Gene model AT1G48440.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 17906075-17907274)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G48440.1                      5'->3' (+)
Promoter sequence






 
AT1G48430.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G48440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+17907046-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+17907003-72
TSS cloneTclone+17907006-69
TSS cloneAclone+17907033-42
TSS cloneGclone+17907034-41
TSS cloneAclone+17907039-36
TSS cloneAclone+17907049-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTAAA+1790684317906850-232-225
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGATAAACCGA+1790685617906864-219-211
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGTATA+1790687817906889-197-186
 AtREG542AAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG629    CCGGTATA PPDB Motif  PLACE Motif 
REGATATTGGGCCGG+1790689517906906-180-169
 AtREG509ATATTGGG     PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGGCK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAGCCCATTAAG+1790691417906924-161-151
 AtREG372AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357 GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396  CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604   CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGCACGTGTT+1790697517906982-100-93
 AtREG590CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2-17907149AT1G48430.1
TSS peakG4-17906786AT1G48430.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-17906793AT1G48430.1
TSS cloneGclone-17906792AT1G48430.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTCTT-1790675317906762AT1G48430.1
Y PatchCTCTCTTCTTCTTCTCT-1790679317906809AT1G48430.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTAACGG-1790684317906850AT1G48430.1
 AtREG610TTTAACGG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGTCGGTTTAT-1790685617906864AT1G48430.1
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598 CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTATACCGGTTTT-1790687817906889AT1G48430.1
 AtREG629TATACCGG     PPDB Motif  PLACE Motif 
 AtREG436   ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542    CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGCCCAATAT-1790689517906906AT1G48430.1
 AtREG457CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414 CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509    CCCAATAT PPDB Motif  PLACE Motif 
REGCTTAATGGGCT-1790691417906924AT1G48430.1
 AtREG604CTTAATGG    PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG   PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAACACGTG-1790697517906982AT1G48430.1
 AtREG590AACACGTGABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.