version
PlantPromoterDB promoter information of AT1G48460.1

Summary of Gene (AT1G48460.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G48460  TAIR      NCBI 
Gene model AT1G48460.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 17910469-17911668)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G48460.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G48460.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAG+1791063317910641-836-828
Y PatchTTTCTCTC+1791067317910680-796-789
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGGTTA+1791044917910460-1020-1009
 AtREG473TTAAACCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTAATTACG+1791052217910529-947-940
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGAGTTGGGCTCA+1791057017910580-899-889
 AtREG607AGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG574 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCAAAGCCCATTAAG+1791059417910607-875-862
 AtREG559CAAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357    GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604      CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGTCGTCGTTTC+1791073017910739-739-730
 AtREG648TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576  GTCGTTTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTAATTA-1791052217910529AT1G48450.1, AT1G48450.2
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 
REGTGAGCCCAACT-1791057017910580AT1G48450.1, AT1G48450.2
 AtREG485TGAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533 GAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607   GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCTTAATGGGCTTTG-1791059417910607AT1G48450.1, AT1G48450.2
 AtREG604CTTAATGG       PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG      PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559      GGGCTTTG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.