version
PlantPromoterDB promoter information of AT1G50000.2

Summary of Gene (AT1G50000.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G50000  TAIR      NCBI 
Gene model AT1G50000.2  
Description methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), Ribosomal RNA small subunit methyltransferase E (InterPro:IPR006700); Has 3924 Blast hits to 3924 proteins in 1156 species: Archae - 0; Bacteria - 2219; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1687 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 18518244-18517045)

Genome position     
from initiation codon
AT1G50000.1         
TSS from cDNA
TSS information
AT1G50000.2                      5'->3' (-)
Promoter sequence




 
AT1G50010.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G50000.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-18517294-50

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGAACCGGAT-1851733718517347-93-103
 AtREG640TTGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGAA-1851735918517368-115-124
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATTGGG-1851751818517525-274-281
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGTACACGTGTA-1851753218517541-288-297
 AtREG453TACACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
REGACGGCACG-1851754718517554-303-310
 AtREG522ACGGCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakT13+18517613AT1G50010.1
TSS peakA2+18517729AT1G50010.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+18517611AT1G50010.1
TSS cloneTclone+18517613AT1G50010.1
TSS cloneAclone+18517614AT1G50010.1
TSS cloneGclone+18517615AT1G50010.1
TSS cloneTclone+18517619AT1G50010.1
TSS cloneAclone+18517622AT1G50010.1
TSS cloneTclone+18517641AT1G50010.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCTTATAAATATA+1851757518517588AT1G50010.1
Y PatchCGTCTTCTTCC+1851768018517690AT1G50010.1
Y PatchCTTTCTTC+1851771718517724AT1G50010.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCGGTTCAA+1851733718517347AT1G50010.1
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480  CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640   CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTCA+1851735918517368AT1G50010.1
 AtREG534TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480  CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCCAATTA+1851751818517525AT1G50010.1
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTACACGTGTA+1851753218517541AT1G50010.1
 AtREG453TACACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
REGCGTGCCGT+1851754718517554AT1G50010.1
 AtREG522CGTGCCGT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.