version
PlantPromoterDB promoter information of AT1G50380.1

Summary of Gene (AT1G50380.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G50380  TAIR      NCBI 
Gene model AT1G50380.1  
Description prolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 18661480-18662679)

Genome position     
from initiation codon
AT1G50370.1         
TSS from cDNA
TSS information
AT1G50380.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G50380.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+18662312-168
TSS clone peakCclone+18662318-162
TSS cloneAclone+18662319-161
TSS cloneCclone+18662320-160

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTCC+1866233918662348-141-132
Y PatchTCCTCTCTCTT+1866235918662369-121-111
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAACCGGAA+1866217918662187-301-293
 AtREG621TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534 AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTTATCCAAACCGGAT+1866219918662218-281-262
 AtREG412CCGGTTTA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598 CGGTTTAT            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550         CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496          CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521           AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561            AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGACACGTA+1866227118662279-209-201
 AtREG472GGACACGT ABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG557 GACACGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.