version
PlantPromoterDB promoter information of AT1G51510.1

Summary of Gene (AT1G51510.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G51510  TAIR      NCBI 
Gene model AT1G51510.1  
Description This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm.  
#
#

Overview

Focused view (chromosome 1: 19105753-19104554)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G51510.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G51510.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-19104848-95

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-19104848-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATTCCTATAAACA-1910487319104889-120-136
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAAGCCCAAAATAAGCCCACT-1910489919104921-146-168
 AtREG549TAAAAGCC                PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529     GCCCAAAA           PPDB MotifGCCCA  PLACE Motif 
 AtREG462            ATAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG426             TAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518              AAGCCCAC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510               AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAGCCCAAAATAAGCCCACTA-1910499919105019-246-266
 AtREG533GAGCCCAA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469 AGCCCAAA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529  GCCCAAAA            PPDB MotifGCCCA  PLACE Motif 
 AtREG462         ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426          TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518           AAGCCCAC   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510            AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532             GCCCACTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.