PlantPromoterDB promoter information of AT1G53850.1
Summary of Gene (AT1G53850.1)
|
Overview
|
Focused view (chromosome 1: 20106792-20105593)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G53850.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G53850.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 8 | - | 20106008 | -216 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | - | 20106015 | -223 |
| TSS clone | A | clone | - | 20106006 | -214 |
| TSS clone | A | clone | - | 20106000 | -208 |
| TSS clone | G | clone | - | 20105994 | -202 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAACGCTGCG | - | 20106053 | 20106062 | -261 | -270 | |||
| AtREG626 | AAACGCTG | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG369 | ACGCTGCG | PPDB Motif | PLACE Motif | ||||||
| REG | GTTAGGCCCATGAAAGCCCATTAT | - | 20106066 | 20106089 | -274 | -297 | |||
| AtREG535 | GTTAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG360 | TTAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG358 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG504 | GGCCCATG | PPDB Motif | GCCCA, CCATGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG357 | GCCCATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG546 | CCCATTAT | PPDB Motif | PLACE Motif | ||||||
| REG | GGCCTAATTGGG | - | 20106108 | 20106119 | -316 | -327 | |||
| AtREG506 | GGCCTAAT | PPDB Motif | PLACE Motif | ||||||
| AtREG600 | TAATTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||