version
PlantPromoterDB promoter information of AT1G55090.1

Summary of Gene (AT1G55090.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G55090  TAIR      NCBI 
Gene model AT1G55090.1  
Description carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, NAD+ synthase (glutamine-hydrolyzing) activity, ATP binding; INVOLVED IN: nitrogen compound metabolic process, NAD biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010), NAD+ synthase (InterPro:IPR003694), Glutamine-dependent NAD(+) synthetase, GAT region (InterPro:IPR014445); Has 3609 Blast hits to 3596 proteins in 1316 species: Archae - 149; Bacteria - 2377; Metazoa - 135; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 843 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 20553857-20555056)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G55090.1                      5'->3' (+)
Promoter sequence





 
AT1G55080.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G55090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+20554357-500

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+20554352-505
TSS cloneGclone+20554437-420
TSS cloneTclone+20554438-419
TSS cloneGclone+20554440-417

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTTCTT+2055439420554405-463-452
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGATGTCG+2055427220554279-585-578
 AtREG630CGATGTCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-20554179AT1G55080.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-20554220AT1G55080.1
TSS cloneGclone-20554212AT1G55080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGACATCG-2055427220554279AT1G55080.1
 AtREG630CGACATCG PPDB Motif  PLACE Motif 
REGATGACACG-2055431120554318AT1G55080.1
 AtREG438ATGACACGABA PPDB Motif  PLACE Motif 
REGGAAACGACGGCGTTTTA-2055436920554385AT1G55080.1
 AtREG576GAAACGAC          PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG         PPDB Motif  PLACE Motif 
 AtREG650        GGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564         GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTCGGTTT-2055441820554425AT1G55080.1
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.