PlantPromoterDB promoter information of AT1G56110.1
Summary of Gene (AT1G56110.1)
|
Overview
|
Focused view (chromosome 1: 20987893-20986694)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G56110.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G56110.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 47 | - | 20986949 | -56 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 20986951 | -58 |
| TSS clone | T | clone | - | 20986948 | -55 |
| TSS clone | A | clone | - | 20986947 | -54 |
| TSS clone | T | clone | - | 20986946 | -53 |
| TSS clone | G | clone | - | 20986911 | -18 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTTCTTCTCCT | - | 20986900 | 20986910 | -7 | -17 |
| Y Patch | TTTCTTCTC | - | 20986936 | 20986944 | -43 | -51 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCGTTAAATGGGCCTGGCCCATTG | - | 20987018 | 20987041 | -125 | -148 | |||
| AtREG610 | CCGTTAAA | PPDB Motif | PLACE Motif | YAACKG, CNGTTR | |||||
| AtREG443 | TAAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG386 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC GGCCCATT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG370 | TGGGCCTG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG619 | GGGCCTGG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG490 | TGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG551 | GCCCATTG | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TGATGGGCCGGG | - | 20987070 | 20987081 | -177 | -188 | |||
| AtREG635 | TGATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG403 | GATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG380 | ATGGGCCG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG457 | TGGGCCGG | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG404 | GGGCCGGG | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC | |||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||