version
PlantPromoterDB promoter information of AT1G60070

Summary of Gene (AT1G60070)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G60070  TAIR      NCBI 
Gene model AT1G60070  
Description binding / clathrin binding / protein binding / protein transporter; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, Golgi apparatus part, Golgi apparatus, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Adaptor protein complex AP-1, gamma subunit (InterPro:IPR017107), Armadillo-like helical (InterPro:IPR011989), Clathrin adaptor, gamma-adaptin, appendage (InterPro:IPR008153), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 2625 Blast hits to 2575 proteins in 190 species: Archae - 0; Bacteria - 4; Metazoa - 1290; Fungi - 597; Plants - 203; Viruses - 0; Other Eukaryotes - 531 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 22150296-22149097)

Genome position     
from initiation codon
AT1G60070.1         
AT1G60072.1         
AT1G60073.1         
TSS from cDNA
TSS information
AT1G60070                        5'->3' (-)
Promoter sequence






 
AT1G60072           
AT1G60072.1         
AT1G60073           
AT1G60073.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G60070

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-22149474-178
TSS peakA13-22149472-176

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-22149526-230
TSS cloneAclone-22149451-155
TSS cloneTclone-22149450-154

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTTTTCTCTCTTC-2214945222149469-156-173
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTAAA-2214955322149560-257-264
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGGGCTTTAA-2214956822149575-272-279
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.