version
PlantPromoterDB promoter information of AT1G62740.1

Summary of Gene (AT1G62740.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G62740  TAIR      NCBI 
Gene model AT1G62740.1  
Description stress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G12270.1); Has 34012 Blast hits to 14045 proteins in 887 species: Archae - 1292; Bacteria - 9292; Metazoa - 8243; Fungi - 1967; Plants - 2227; Viruses - 4; Other Eukaryotes - 10987 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 23230026-23231225)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G62740.1                      5'->3' (+)
Promoter sequence


 
AT1G62730.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G62740.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+23230987-39

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+23230941-85
TSS cloneCclone+23230942-84
TSS cloneAclone+23230961-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGTCGTC+2323073523230742-291-284
 AtREG526ACGTCGTC PPDB MotifACGT  PLACE MotifACGT 
REGACGACGTC+2323077223230779-254-247
 AtREG431ACGACGTC PPDB MotifACGT  PLACE MotifACGT 
REGAGTCGGTT+2323080323230810-223-216
 AtREG641AGTCGGTT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGATGACACGACGACGT+2323082123230835-205-191
 AtREG438ATGACACG       ABA PPDB Motif  PLACE Motif 
 AtREG526       GACGACGT PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-23230721AT1G62730.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTCC-2323070323230712AT1G62730.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGTCGT-2323077223230779AT1G62730.1
 AtREG431GACGTCGT PPDB MotifACGT  PLACE MotifACGT 
REGAACCGACT-2323080323230810AT1G62730.1
 AtREG641AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGACGTCGTCGTGTCAT-2323082123230835AT1G62730.1
 AtREG526ACGTCGTC        PPDB MotifACGT  PLACE MotifACGT 
 AtREG438       CGTGTCATABA PPDB Motif  PLACE Motif 
REGCTAATGGG-2323095523230962AT1G62730.1
 AtREG558CTAATGGG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.