version
PlantPromoterDB promoter information of AT1G62820.1

Summary of Gene (AT1G62820.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G62820  TAIR      NCBI 
Gene model AT1G62820.1  
Description calmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G12310.1); Has 12799 Blast hits to 10828 proteins in 1248 species: Archae - 0; Bacteria - 22; Metazoa - 5376; Fungi - 3677; Plants - 2002; Viruses - 0; Other Eukaryotes - 1722 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 23265268-23264069)

Genome position     
from initiation codon
AT1G62830.1         
TSS from cDNA
TSS information
AT1G62820.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G62820.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-23264314-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-23265028-760
TSS cloneGclone-23264349-81
TSS cloneTclone-23264348-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGACGT-2326441023264422-142-154
 AtREG520AAAACGAC      PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG     PPDB Motif  PLACE Motif 
 AtREG648  AACGACGA    PPDB Motif  PLACE Motif 
 AtREG526     GACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGATGGGCTTAGGAAGCCCATATA-2326444523264466-177-198
 AtREG426 TGGGCTTA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634  GGGCTTAG             PPDB MotifGCCCA  PLACE Motif 
 AtREG476          GAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378ATGGGCTT   AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477            AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432             GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620              CCCATATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.