PlantPromoterDB promoter information of AT1G63940.1

Summary of Gene (AT1G63940.1)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G63940 TAIR NCBI
Gene model	AT1G63940.1
Description	monodehydroascorbate reductase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: response to cadmium ion, response to cold; LOCATED IN: mitochondrion, stromule, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027); BEST Arabidopsis thaliana protein match is: ATMDAR2; monodehydroascorbate reductase (NADH) (TAIR:AT5G03630.1); Has 19261 Blast hits to 19238 proteins in 1797 species: Archae - 414; Bacteria - 13253; Metazoa - 865; Fungi - 447; Plants - 361; Viruses - 0; Other Eukaryotes - 3921 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 23727506-23728705)

`Genome position from initiation codon` `AT1G63920.1 AT1G63930.1 TSS from cDNA TSS information AT1G63940.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G63940.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 4 + 23729890 -316

TSS peak A 15 + 23730122 -84

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	4	+	23729890	-316
TSS peak	`A`	15	+	23730122	-84

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone + 23729981 -225

TSS clone C clone + 23730050 -156

TSS clone T clone + 23730052 -154

TSS clone A clone + 23730087 -119

TSS clone A clone + 23730094 -112

TSS clone A clone + 23730122 -84

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	+	23729981	-225
TSS clone	`C`	clone	+	23730050	-156
TSS clone	`T`	clone	+	23730052	-154
TSS clone	`A`	clone	+	23730087	-119
TSS clone	`A`	clone	+	23730094	-112
TSS clone	`A`	clone	+	23730122	-84

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTTATAAACT + 23730084 23730093 -122 -113

Y Patch CTCTTCTT + 23730079 23730086 -127 -120

Y Patch TCTCTCTC + 23730114 23730121 -92 -85

Y Patch TCTTCTTCCTC + 23730133 23730143 -73 -63

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTATAAACT`	+	23730084	23730093	-122	-113
Y Patch	`CTCTTCTT`	+	23730079	23730086	-127	-120
Y Patch	`TCTCTCTC`	+	23730114	23730121	-92	-85
Y Patch	`TCTTCTTCCTC`	+	23730133	23730143	-73	-63
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None