PlantPromoterDB promoter information of AT1G65010

Summary of Gene (AT1G65010)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G65010 TAIR NCBI
Gene model	AT1G65010
Description	unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 289245 Blast hits to 110345 proteins in 2676 species: Archae - 3808; Bacteria - 54712; Metazoa - 119193; Fungi - 19166; Plants - 10632; Viruses - 1818; Other Eukaryotes - 79916 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 24146793-24147992)

`Genome position from initiation codon` `AT1G65000.1 TSS from cDNA TSS information AT1G65010 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G65010

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 8 + 24149308 -235

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	8	+	24149308	-235

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTCCT + 24149313 24149320 -230 -223

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTCCT`	+	24149313	24149320	-230	-223
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATAAAGCC + 24149139 24149146 -404 -397

AtREG601 ATAAAGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATAAAGCC`		+	24149139	24149146	-404	-397
	AtREG601	`ATAAAGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 + 24147052 AT1G65000.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	+	24147052	AT1G65000.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone + 24147040 AT1G65000.1

TSS clone A clone + 24147044 AT1G65000.1

TSS clone A clone + 24147048 AT1G65000.1

TSS clone C clone + 24147058 AT1G65000.1

TSS clone G clone + 24147061 AT1G65000.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	+	24147040	AT1G65000.1
TSS clone	`A`	clone	+	24147044	AT1G65000.1
TSS clone	`A`	clone	+	24147048	AT1G65000.1
TSS clone	`C`	clone	+	24147058	AT1G65000.1
TSS clone	`G`	clone	+	24147061	AT1G65000.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCCAATAAGCCCATTAAGGCCCATAA + 24146975 24147000 AT1G65000.1

AtREG417 CCCAATAA                   PPDB Motif GCCCA PLACE Motif

AtREG611 CCAATAAG                  PPDB Motif PLACE Motif

AtREG462     ATAAGCCC               PPDB Motif GCCCA PLACE Motif

AtREG426      TAAGCCCA              PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG378       AAGCCCAT             PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG372        AGCCCATT            PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG357         GCCCATTA           PPDB Motif GCCCA PLACE Motif

AtREG396          CCCATTAA          PPDB Motif GCCCA PLACE Motif TTAATGG

AtREG604           CCATTAAG         PPDB Motif PLACE Motif TTAATGG

AtREG416              TTAAGGCC      PPDB Motif PLACE Motif

AtREG351               TAAGGCCC     PPDB Motif GCCCA PLACE Motif GGGCC

AtREG353                AAGGCCCA    PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG354                 AGGCCCAT   PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG364                  GGCCCATA PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG394                   GCCCATAA PPDB Motif GCCCA PLACE Motif