version
PlantPromoterDB promoter information of AT1G65150.1

Summary of Gene (AT1G65150.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G65150  TAIR      NCBI 
Gene model AT1G65150.1  
Description meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 24206558-24205359)

Genome position     
from initiation codon
AT1G65150.2         
TSS from cDNA
TSS information
AT1G65150.1                      5'->3' (-)
Promoter sequence





 
AT1G65160.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G65150.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-24205738-180

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-24205737-179

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTTT-2420574424205754-186-196
Y PatchCTCTCTCCT-2420576224205770-204-212
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCTAGA-2420581324205820-255-262
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGTTTAGGCCCGTTA-2420583924205851-281-293
 AtREG430TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT   PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG401    GGCCCGTT  PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG399     GCCCGTTA PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
REGCGTTTTGA-2420589824205905-340-347
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.