version
PlantPromoterDB promoter information of AT1G65930

Summary of Gene (AT1G65930)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G65930  TAIR      NCBI 
Gene model AT1G65930  
Description isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: apoplast, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: ICDH (ISOCITRATE DEHYDROGENASE); isocitrate dehydrogenase (NADP+)/ oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor (TAIR:AT1G54340.1); Has 4101 Blast hits to 4085 proteins in 611 species: Archae - 17; Bacteria - 632; Metazoa - 448; Fungi - 160; Plants - 247; Viruses - 0; Other Eukaryotes - 2597 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 24538088-24539287)

Genome position     
from initiation codon
AT1G65930.1         
TSS from cDNA
TSS information
AT1G65930                        5'->3' (+)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G65930

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA115+24538935-153

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+24538904-184
TSS cloneTclone+24538930-158
TSS cloneTclone+24538932-156
TSS cloneAclone+24538933-155
TSS cloneAclone+24538935-153
TSS cloneAclone+24538936-152
TSS cloneGclone+24538937-151
TSS cloneCclone+24538938-150
TSS cloneTclone+24538939-149
TSS cloneTclone+24538941-147
TSS cloneCclone+24538946-142
TSS cloneCclone+24538965-123

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTC+2453897624538983-112-105
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGACCC+2453879124538799-297-289
 AtREG406GTGGGACC  PPDB MotifGGGACCC  PLACE Motif 
 AtREG596 TGGGACCC PPDB MotifGGGACCC  PLACE Motif 
REGGGGTCAAA+2453887124538878-217-210
 AtREG592GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.