PlantPromoterDB promoter information of AT1G68520

Summary of Gene (AT1G68520)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G68520 TAIR NCBI
Gene model	AT1G68520
Description	zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G25440.1); Has 2123 Blast hits to 1331 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 2036; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 25713199-25712000)

`Genome position from initiation codon` `AT1G68526.1 AT1G68530.1 AT1G68530.2 TSS from cDNA TSS information AT1G68520 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G68520

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 2 - 25710967 -218

TSS peak G 13 - 25710856 -107

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	2	-	25710967	-218
TSS peak	`G`	13	-	25710856	-107

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 25710879 -130

TSS clone C clone - 25710878 -129

TSS clone G clone - 25710856 -107

TSS clone T clone - 25710855 -106

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	25710879	-130
TSS clone	`C`	clone	-	25710878	-129
TSS clone	`G`	clone	-	25710856	-107
TSS clone	`T`	clone	-	25710855	-106

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTCTTT - 25710888 25710896 -139 -147

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTCTTT`	-	25710888	25710896	-139	-147
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AAAACGACA - 25711158 25711166 -409 -417

AtREG520 AAAACGAC PPDB Motif PLACE Motif

AtREG569 AAACGACA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AAAACGACA`		-	25711158	25711166	-409	-417
	AtREG520	`AAAACGAC`		PPDB Motif		PLACE Motif
	AtREG569	`AAACGACA`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone peak A clone - 25713154 AT1G68526.1

TSS clone peak A clone - 25712949 AT1G68526.1

TSS clone peak A clone - 25712938 AT1G68526.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone peak	`A`	clone	-	25713154	AT1G68526.1
TSS clone peak	`A`	clone	-	25712949	AT1G68526.1
TSS clone peak	`A`	clone	-	25712938	AT1G68526.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None