version
PlantPromoterDB promoter information of AT1G71260.1

Summary of Gene (AT1G71260.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G71260  TAIR      NCBI 
Gene model AT1G71260.1  
Description Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus.  
#
#

Overview

Focused view (chromosome 1: 26864391-26863192)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G71260.1                      5'->3' (-)
Promoter sequence












 
AT1G71270.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G71260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-26863418-27

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-26863418-27

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAGGCCCATTGGGCCGTTAAA-2686351526863537-124-146
 AtREG467TAAAGGCC                PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551     GCCCATTG           PPDB MotifGCCCA  PLACE Motif 
 AtREG461        CATTGGGC        PPDB MotifGCCCA  PLACE Motif 
 AtREG352         ATTGGGCC       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414          TTGGGCCG      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368           TGGGCCGT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377            GGGCCGTT    PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG610               CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+26863586AT1G71270.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+26863587AT1G71270.1
TSS cloneGclone+26863595AT1G71270.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCAAAACG+2686345626863463AT1G71270.1
 AtREG653TCAAAACG PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTTAACGGCCCAATGGGCCTTTA+2686351526863537AT1G71270.1
 AtREG610TTTAACGG                PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG377   AACGGCCC             PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG368    ACGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414     CGGCCCAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352      GGCCCAAT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461       GCCCAATG         PPDB MotifGCCCA  PLACE Motif 
 AtREG551          CAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361           AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354            ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353             TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359              GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG467               GGCCTTTA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.