PlantPromoterDB promoter information of AT1G72520

Summary of Gene (AT1G72520)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G72520 TAIR NCBI
Gene model	AT1G72520
Description	lipoxygenase, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth, jasmonic acid biosynthetic process, response to wounding, defense response; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Lipoxygenase, C-terminal (InterPro:IPR013819), Lipoxygenase (InterPro:IPR000907), Lipoxygenase, plant (InterPro:IPR001246); BEST Arabidopsis thaliana protein match is: LOX3; electron carrier/ iron ion binding / lipoxygenase/ metal ion binding / oxidoreductase, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (TAIR:AT1G17420.1); Has 1119 Blast hits to 1103 proteins in 149 species: Archae - 0; Bacteria - 68; Metazoa - 485; Fungi - 38; Plants - 512; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 27307611-27308810)

`Genome position from initiation codon` `AT1G72520.1 TSS from cDNA TSS information AT1G72520 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G72520

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 8 + 27308513 -98

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	8	+	27308513	-98

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 27308519 -92

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	27308519	-92

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CATATAAATA + 27308479 27308488 -132 -123

Y Patch CTCTCTTTCTC + 27308464 27308474 -147 -137

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CATATAAATA`	+	27308479	27308488	-132	-123
Y Patch	`CTCTCTTTCTC`	+	27308464	27308474	-147	-137
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CGCGTTTTA + 27308334 27308342 -277 -269

AtREG566 CGCGTTTT PPDB Motif AAACG(C/G) PLACE Motif

AtREG564 GCGTTTTA PPDB Motif AAACG(C/G) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CGCGTTTTA`		+	27308334	27308342	-277	-269
	AtREG566	`CGCGTTTT`		PPDB Motif	`AAACG(C/G)`	PLACE Motif
	AtREG564	`GCGTTTTA`		PPDB Motif	`AAACG(C/G)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None