PlantPromoterDB promoter information of AT1G74970
Summary of Gene (AT1G74970)
|
Overview
|
Focused view (chromosome 1: 28160202-28159003)
|
Genome position
from initiation codon AT1G74990.1 TSS from cDNA TSS information AT1G74970 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G74970
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | C | 8 | - | 28159252 | -50 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 28159301 | -99 |
| TSS clone | C | clone | - | 28159290 | -88 |
| TSS clone | A | clone | - | 28159269 | -67 |
| TSS clone | C | clone | - | 28159268 | -66 |
| TSS clone | C | clone | - | 28159267 | -65 |
| TSS clone | T | clone | - | 28159264 | -62 |
| TSS clone | A | clone | - | 28159260 | -58 |
| TSS clone | T | clone | - | 28159253 | -51 |
| TSS clone | C | clone | - | 28159251 | -49 |
| TSS clone | T | clone | - | 28159250 | -48 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTCTTC | - | 28159214 | 28159221 | -12 | -19 |
| Y Patch | TCTTCTTCCT | - | 28159274 | 28159283 | -72 | -81 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTAATGGGCTCTAATGGGCCGAT | - | 28159351 | 28159373 | -149 | -171 | |||
| AtREG396 | TTAATGGG | PPDB Motif | GCCCA | PLACE Motif | TTAATGG | ||||
| AtREG357 | TAATGGGC TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG558 | CTAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG380 | ATGGGCCG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG393 | TGGGCCGA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG555 | GGGCCGAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| REG | TAAGCCCAATG | - | 28159381 | 28159391 | -179 | -189 | |||
| AtREG426 | TAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG461 | GCCCAATG | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||