PlantPromoterDB promoter information of AT1G75780.1
Summary of Gene (AT1G75780.1)
|
Overview
|
Focused view (chromosome 1: 28458902-28457703)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G75780.1 5'->3' (-) Promoter sequence AT1G75800.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G75780.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 13 | - | 28453691 | -89 |
| TSS peak | A | 13 | - | 28453634 | -32 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 28453640 | -38 |
| TSS clone | T | clone | - | 28453639 | -37 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTCTCCTCCTTCTTCTCCTTC | - | 28453644 | 28453664 | -42 | -62 |
| Y Patch | CCTCTCTCTCTCCCTCTCC | - | 28453672 | 28453690 | -70 | -88 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CGGTTAAA | - | 28453759 | 28453766 | -157 | -164 | |||
| AtREG645 | CGGTTAAA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| REG | AAAGTCAA | - | 28453836 | 28453843 | -234 | -241 | |||
| AtREG632 | AAAGTCAA | PPDB Motif | PLACE Motif | TTGAC | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 69 | + | 28458789 | AT1G75800.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | C | clone | + | 28458782 | AT1G75800.1 |
| TSS clone | C | clone | + | 28458784 | AT1G75800.1 |
| TSS clone | T | clone | + | 28458787 | AT1G75800.1 |
| TSS clone | A | clone | + | 28458789 | AT1G75800.1 |
| TSS clone | G | clone | + | 28458790 | AT1G75800.1 |
| TSS clone | A | clone | + | 28458791 | AT1G75800.1 |
| TSS clone | A | clone | + | 28458830 | AT1G75800.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TACTATAAAGC | + | 28458745 | 28458755 | AT1G75800.1 | |
| Y Patch | TCTTCTTCTTCATCTCTCTTTC | + | 28458761 | 28458782 | AT1G75800.1 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | CCCATTAT | + | 28458548 | 28458555 | AT1G75800.1 | ||||
| AtREG546 | CCCATTAT | PPDB Motif | PLACE Motif | ||||||
| REG | CGGTTAAA | + | 28458640 | 28458647 | AT1G75800.1 | ||||
| AtREG645 | CGGTTAAA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| REG | GTCCACGT | + | 28458668 | 28458675 | AT1G75800.1 | ||||
| AtREG513 | GTCCACGT | ABA, DREB1Aox | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||