version
PlantPromoterDB promoter information of AT1G75870.1

Summary of Gene (AT1G75870.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G75870  TAIR      NCBI 
Gene model AT1G75870.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 28485532-28486731)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G75870.1                      5'->3' (+)
Promoter sequence




 
AT1G75860.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G75870.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+28486455-77

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTATAAGT+2848641128486418-121-114
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGACTTT+2848618628486193-346-339
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGATAGGCCTAAT+2848622128486231-311-301
 AtREG649ATAGGCCT    PPDB Motif  PLACE Motif 
 AtREG506   GGCCTAAT PPDB Motif  PLACE Motif 
REGTTATTGGGC+2848623728486245-295-287
 AtREG417TTATTGGG  PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAAAAGCCCAC+2848626028486270-272-262
 AtREG549TAAAAGCC    PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAAGGCCCGTT+2848628728486298-245-234
 AtREG459AAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT  PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG401    GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
REGAAACGCGTTT+2848635128486360-181-172
 AtREG633AAACGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-28485957AT1G75860.1
TSS clone peakTclone-28485954AT1G75860.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.