PlantPromoterDB promoter information of AT1G78920.1
Summary of Gene (AT1G78920.1)
|
Overview
|
Focused view (chromosome 1: 29671340-29672539)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G78920.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G78920.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 5 | + | 29671552 | -788 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | + | 29671495 | -845 |
| TSS clone | T | clone | + | 29671539 | -801 |
| TSS clone | G | clone | + | 29671585 | -755 |
| TSS clone | A | clone | + | 29671588 | -752 |
| TSS clone | G | clone | + | 29671594 | -746 |
| TSS clone | G | clone | + | 29671607 | -733 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TATATGGGCCGAA | + | 29671269 | 29671281 | -1071 | -1059 | |||
| AtREG620 | TATATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG432 | ATATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG364 | TATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG380 | ATGGGCCG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG393 | TGGGCCGA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG427 | GGGCCGAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| REG | TTTTGGGCTAGGCCCATATA | + | 29671295 | 29671314 | -1045 | -1026 | |||
| AtREG529 | TTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG469 | TTTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG475 | CTAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG358 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG364 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG432 | GCCCATAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG620 | CCCATATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGGTATTT | + | 29671345 | 29671352 | -995 | -988 | |||
| AtREG602 | GGGTATTT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||