PlantPromoterDB promoter information of AT1G80245.2

Summary of Gene (AT1G80245.2)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G80245 TAIR NCBI
Gene model	AT1G80245.2
Description	FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00695.2); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 30175197-30176396)

`Genome position from initiation codon` `AT1G80245.1 AT1G80245.3 AT1G80260.1 TSS from cDNA TSS information AT1G80245.2 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G80245.2

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak G clone + 30174179 -368

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`G`	clone	+	30174179	-368

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 2 + 30175804 AT1G80260.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	2	+	30175804	AT1G80260.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone + 30175785 AT1G80260.1

TSS clone G clone + 30175786 AT1G80260.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	+	30175785	AT1G80260.1
TSS clone	`G`	clone	+	30175786	AT1G80260.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTCTCCTCT + 30175794 30175802 AT1G80260.1

Y Patch TCTCTCTC + 30175808 30175815 AT1G80260.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTCTCCTCT`	+	30175794	30175802	AT1G80260.1
Y Patch	`TCTCTCTC`	+	30175808	30175815	AT1G80260.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None