version
PlantPromoterDB promoter information of AT1G80620.1

Summary of Gene (AT1G80620.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G80620  TAIR      NCBI 
Gene model AT1G80620.1  
Description ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G15810.1); Has 5440 Blast hits to 5440 proteins in 1548 species: Archae - 0; Bacteria - 3063; Metazoa - 73; Fungi - 72; Plants - 237; Viruses - 0; Other Eukaryotes - 1995 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 30304404-30305603)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G80620.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G80620.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+30305383-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+30305360-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGACTTT+3030522630305233-178-171
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTCCGGTTTAC+3030529230305302-112-102
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519   CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGAC+3030530730305315-97-89
 AtREG579GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573 AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.