PlantPromoterDB promoter information of AT2G01180.1
Summary of Gene (AT2G01180.1)
|
Overview
|
Focused view (chromosome 2: 109555-108356)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G01180.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G01180.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 108802 | -247 |
| TSS clone peak | C | clone | - | 108635 | -80 |
| TSS clone peak | A | clone | - | 108619 | -64 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTTCTTCT | - | 108752 | 108759 | -197 | -204 |
| Y Patch | TCTCTCTCT | - | 108762 | 108770 | -207 | -215 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAGTCAAAAGTCAA | - | 108802 | 108816 | -247 | -261 | |||
| AtREG632 | AAAGTCAAAAGTCAA | PPDB Motif | PLACE Motif | TTGAC | |||||
| REG | GTGGGACC | - | 108867 | 108874 | -312 | -319 | |||
| AtREG406 | GTGGGACC | PPDB Motif | GGGACCC | PLACE Motif | |||||
| REG | TAAGCCCAC | - | 108920 | 108928 | -365 | -373 | |||
| AtREG426 | TAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG518 | AAGCCCAC | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | AAGGCCCATAATAAGGCCTAAT | - | 108937 | 108958 | -382 | -403 | |||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG364 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG394 | GCCCATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG425 | ATAAGGCC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG506 | GGCCTAAT | PPDB Motif | PLACE Motif | ||||||
| REG | ATATGGGCT | - | 109072 | 109080 | -517 | -525 | |||
| AtREG432 | ATATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG477 | TATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | TGGGCTTTA | - | 109082 | 109090 | -527 | -535 | |||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG365 | GGGCTTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||