version
PlantPromoterDB promoter information of AT2G02000.1

Summary of Gene (AT2G02000.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G02000  TAIR      NCBI 
Gene model AT2G02000.1  
Description glutamate decarboxylase 3 (GAD3); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process, glutamate metabolic process, glutamate decarboxylation to succinate; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent decarboxylase (InterPro:IPR002129), Glutamate decarboxylase (InterPro:IPR010107), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GAD4 (glutamate decarboxylase 4); calmodulin binding (TAIR:AT2G02010.1); Has 1647 Blast hits to 1645 proteins in 499 species: Archae - 126; Bacteria - 839; Metazoa - 130; Fungi - 220; Plants - 174; Viruses - 7; Other Eukaryotes - 151 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 472997-471798)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G02000.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G02000.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-472070-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATATATACC-472095472108-98-111
Y PatchCTCCTCTTCTTCT-472077472089-80-92
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGCCCATAA-472217472226-220-229
 AtREG581TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477 AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394  GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTAGCCCATAA-472260472269-263-272
 AtREG581TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477 AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394  GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCGTTTTGA-472288472295-291-298
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.