PlantPromoterDB promoter information of AT2G02100

Summary of Gene (AT2G02100)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G02100 TAIR NCBI
Gene model	AT2G02100
Description	Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.

#

Overview

Focused view (chromosome 2: 537147-538346)

`Genome position from initiation codon` `AT2G02120.1 TSS from cDNA TSS information AT2G02100 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G02100

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 146 + 528353 -44

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	146	+	528353	-44

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone + 528197 -200

TSS clone C clone + 528342 -55

TSS clone A clone + 528350 -47

TSS clone A clone + 528353 -44

TSS clone C clone + 528354 -43

TSS clone C clone + 528356 -41

TSS clone T clone + 528357 -40

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	+	528197	-200
TSS clone	`C`	clone	+	528342	-55
TSS clone	`A`	clone	+	528350	-47
TSS clone	`A`	clone	+	528353	-44
TSS clone	`C`	clone	+	528354	-43
TSS clone	`C`	clone	+	528356	-41
TSS clone	`T`	clone	+	528357	-40

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TCTTTATATAGT + 528317 528328 -80 -69

Y Patch CTCTCTTT + 528314 528321 -83 -76

Y Patch CTCTCTCTTT + 528375 528384 -22 -13

Y Patch TCTCTCTT + 528386 528393 -11 -4

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTTTATATAGT`	+	528317	528328	-80	-69
Y Patch	`CTCTCTTT`	+	528314	528321	-83	-76
Y Patch	`CTCTCTCTTT`	+	528375	528384	-22	-13
Y Patch	`TCTCTCTT`	+	528386	528393	-11	-4
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AAACGCGT + 528268 528275 -129 -122

AtREG633 AAACGCGT PPDB Motif AAACG(C/G) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AAACGCGT`		+	528268	528275	-129	-122
	AtREG633	`AAACGCGT`		PPDB Motif	`AAACG(C/G)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone + 538250 AT2G02120.1

TSS clone G clone + 538251 AT2G02120.1

TSS clone peak T clone + 538252 AT2G02120.1

TSS clone peak C clone + 538254 AT2G02120.1

TSS clone A clone + 538255 AT2G02120.1

TSS clone C clone + 538256 AT2G02120.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	+	538250	AT2G02120.1
TSS clone	`G`	clone	+	538251	AT2G02120.1
TSS clone peak	`T`	clone	+	538252	AT2G02120.1
TSS clone peak	`C`	clone	+	538254	AT2G02120.1
TSS clone	`A`	clone	+	538255	AT2G02120.1
TSS clone	`C`	clone	+	538256	AT2G02120.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TCTTTATATAGT + 538218 538229 AT2G02120.1

Y Patch TCTCTCTC + 538287 538294 AT2G02120.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTTTATATAGT`	+	538218	538229	AT2G02120.1
Y Patch	`TCTCTCTC`	+	538287	538294	AT2G02120.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CGTGTCAC + 537969 537976 AT2G02120.1

AtREG498 CGTGTCAC ABA PPDB Motif PLACE Motif